ID: 1127843348_1127843365

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1127843348 1127843365
Species Human (GRCh38) Human (GRCh38)
Location 15:62848696-62848718 15:62848747-62848769
Sequence CCAAACACCTACCACCCACCACA CGTGGCCTTGCCATGCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 81, 4: 653} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!