ID: 1128352740_1128352743

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1128352740 1128352743
Species Human (GRCh38) Human (GRCh38)
Location 15:66901950-66901972 15:66901964-66901986
Sequence CCAGCTTCCCTGGGTGGCAGGGC TGGCAGGGCTGCTTCCCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 450} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!