ID: 1128547333_1128547339

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1128547333 1128547339
Species Human (GRCh38) Human (GRCh38)
Location 15:68577335-68577357 15:68577354-68577376
Sequence CCTTCCCTTCTCTAAATCCGTTT GTTTACTCATCAGCAAAATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 20, 2: 267, 3: 1822, 4: 5812}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!