ID: 1128743670_1128743679

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1128743670 1128743679
Species Human (GRCh38) Human (GRCh38)
Location 15:70099243-70099265 15:70099295-70099317
Sequence CCGGATCTATATTTTCCCCTCAT AATGAGGAGCTGAGAGCTAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 234} {0: 1, 1: 0, 2: 2, 3: 27, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!