ID: 1128766311_1128766320

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1128766311 1128766320
Species Human (GRCh38) Human (GRCh38)
Location 15:70253199-70253221 15:70253228-70253250
Sequence CCCAAGTCCCTATGTTCTTTCCC CTTTCCTTCCAAGCACCCCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 23, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!