ID: 1128842243_1128842250

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1128842243 1128842250
Species Human (GRCh38) Human (GRCh38)
Location 15:70859758-70859780 15:70859782-70859804
Sequence CCAACGCCAAGCTGTCCGAGCTG AGGCCTCTCTGCAATGGGCCAGG
Strand - +
Off-target summary {0: 7, 1: 13, 2: 13, 3: 13, 4: 72} {0: 1, 1: 0, 2: 0, 3: 18, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!