ID: 1129038247_1129038261

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1129038247 1129038261
Species Human (GRCh38) Human (GRCh38)
Location 15:72664041-72664063 15:72664093-72664115
Sequence CCCACGGTGCCCTCGCTACCCTA ACCATGTGCCCTCATGCCCAGGG
Strand - +
Off-target summary {0: 5, 1: 23, 2: 9, 3: 8, 4: 52} {0: 6, 1: 3, 2: 8, 3: 43, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!