ID: 1129038578_1129038589

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1129038578 1129038589
Species Human (GRCh38) Human (GRCh38)
Location 15:72665565-72665587 15:72665611-72665633
Sequence CCGAGATGTGACCCCATTATTTT CTCCCGAAGGAGAAGGCGGACGG
Strand - +
Off-target summary {0: 7, 1: 4, 2: 2, 3: 23, 4: 193} {0: 4, 1: 1, 2: 1, 3: 6, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!