ID: 1129162243_1129162267

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129162243 1129162267
Species Human (GRCh38) Human (GRCh38)
Location 15:73753226-73753248 15:73753260-73753282
Sequence CCCCGGCCGCCCCCGGCCCGCCC GCCGGACTGGCCGCCCGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 53, 3: 279, 4: 2184} {0: 1, 1: 0, 2: 2, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!