ID: 1129162245_1129162256 |
View in Genome Browser |
Spacer: -4 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1129162245 | 1129162256 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 15:73753228-73753250 | 15:73753247-73753269 |
Sequence | CCGGCCGCCCCCGGCCCGCCCCG | CCCGCCGCCCCCCGCCGGACTGG |
Strand | - | + |
Off-target summary | {0: 2, 1: 6, 2: 35, 3: 325, 4: 2093} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |