ID: 1129162265_1129162277

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1129162265 1129162277
Species Human (GRCh38) Human (GRCh38)
Location 15:73753258-73753280 15:73753295-73753317
Sequence CCGCCGGACTGGCCGCCCGGGCG TAAAGGCCGCCCGGCTCGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109} {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!