ID: 1129162270_1129162277

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1129162270 1129162277
Species Human (GRCh38) Human (GRCh38)
Location 15:73753270-73753292 15:73753295-73753317
Sequence CCGCCCGGGCGGGCGCTGGCTCC TAAAGGCCGCCCGGCTCGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 17, 4: 248} {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!