ID: 1129162991_1129163006

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129162991 1129163006
Species Human (GRCh38) Human (GRCh38)
Location 15:73757637-73757659 15:73757671-73757693
Sequence CCAGAGGGTTGGGACCTGCTGCC GAGGGGAAGTGGGGGCATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 303} {0: 1, 1: 0, 2: 1, 3: 32, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!