ID: 1129336304_1129336308

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1129336304 1129336308
Species Human (GRCh38) Human (GRCh38)
Location 15:74854159-74854181 15:74854200-74854222
Sequence CCATTAGCTGGTGACGAGGGGGC GTGATGTGCCCCTGCCTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55} {0: 1, 1: 0, 2: 4, 3: 19, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!