ID: 1129336306_1129336315

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1129336306 1129336315
Species Human (GRCh38) Human (GRCh38)
Location 15:74854185-74854207 15:74854213-74854235
Sequence CCCACAGCAGGATGAGTGATGTG GCCTGTGAGGGGACTCCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 153} {0: 1, 1: 0, 2: 0, 3: 16, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!