ID: 1129398768_1129398776

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129398768 1129398776
Species Human (GRCh38) Human (GRCh38)
Location 15:75267912-75267934 15:75267946-75267968
Sequence CCCTATTAATGGGCCCAGAATCT ACCATGTGCCCTCATGCCCAGGG
Strand - +
Off-target summary {0: 25, 1: 4, 2: 24, 3: 3, 4: 104} {0: 6, 1: 3, 2: 8, 3: 43, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!