ID: 1129452109_1129452117

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1129452109 1129452117
Species Human (GRCh38) Human (GRCh38)
Location 15:75656958-75656980 15:75656999-75657021
Sequence CCAGGCGCCTTCGCCAAGGTGAA TGACGAGGGCCGCATGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 49} {0: 1, 1: 0, 2: 1, 3: 9, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!