|
Left Crispr |
Right Crispr |
| Crispr ID |
1129564391 |
1129564397 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:76606559-76606581
|
15:76606595-76606617
|
| Sequence |
CCTGGATATCCTTGTTAACTTTC |
TGTCTAATGTTGACAGTGGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1971, 1: 2961, 2: 4902, 3: 2274, 4: 1449} |
{0: 11, 1: 5, 2: 18, 3: 21, 4: 156} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|