ID: 1129738803_1129738810

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1129738803 1129738810
Species Human (GRCh38) Human (GRCh38)
Location 15:77979964-77979986 15:77979984-77980006
Sequence CCAGCACCAGGGCCCTCCCCTCC TCCTCGTGTGTTGCAGAACGTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 12, 3: 72, 4: 848} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!