ID: 1129776372_1129776379

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1129776372 1129776379
Species Human (GRCh38) Human (GRCh38)
Location 15:78239287-78239309 15:78239329-78239351
Sequence CCGGATCCAGACGGATGGCAGTC CGGCAAACAGCAGTGGTGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 27, 3: 76, 4: 175} {0: 62, 1: 126, 2: 64, 3: 58, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!