ID: 1129838265_1129838269

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1129838265 1129838269
Species Human (GRCh38) Human (GRCh38)
Location 15:78727424-78727446 15:78727447-78727469
Sequence CCCTTCAGCAAGCAGCTCAGGCC CTGCCCTCACCAATCACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 33, 4: 259} {0: 7, 1: 4, 2: 42, 3: 30, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!