ID: 1129908284_1129908299

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1129908284 1129908299
Species Human (GRCh38) Human (GRCh38)
Location 15:79205288-79205310 15:79205340-79205362
Sequence CCTGTCCTGAGTCAGTCCTTTCC AAGCAGGACTGCACCAGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!