|
Left Crispr |
Right Crispr |
| Crispr ID |
1129918515 |
1129918522 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:79296736-79296758
|
15:79296782-79296804
|
| Sequence |
CCTCCACTCACTAGATGGCAGTA |
ACCAAAAATGTCTCTAGACGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 125, 3: 477, 4: 1088} |
{0: 1, 1: 6, 2: 37, 3: 85, 4: 181} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|