ID: 1129931270_1129931279

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1129931270 1129931279
Species Human (GRCh38) Human (GRCh38)
Location 15:79412806-79412828 15:79412846-79412868
Sequence CCACCCATTGGAGTGTTGTGACC TTGGCTGCACCCAGCACAGTGGG
Strand - +
Off-target summary {0: 4, 1: 21, 2: 67, 3: 78, 4: 164} {0: 1, 1: 1, 2: 1, 3: 24, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!