|
Left Crispr |
Right Crispr |
| Crispr ID |
1130141974 |
1130141978 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:81235225-81235247
|
15:81235273-81235295
|
| Sequence |
CCTGAGACTGGGTAATTTTTAAA |
TTCTGCAAGCTATACAAGCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 105, 1: 6924, 2: 13682, 3: 14413, 4: 11439} |
{0: 4, 1: 47, 2: 382, 3: 498, 4: 571} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|