|
Left Crispr |
Right Crispr |
| Crispr ID |
1130259931 |
1130259940 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:82346789-82346811
|
15:82346821-82346843
|
| Sequence |
CCTGCAGGGTCACTGCACCTCGG |
TCTTACCTCCAGATCCTGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 17, 2: 10, 3: 20, 4: 116} |
{0: 2, 1: 22, 2: 20, 3: 22, 4: 177} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|