ID: 1130260314_1130260325

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1130260314 1130260325
Species Human (GRCh38) Human (GRCh38)
Location 15:82349086-82349108 15:82349128-82349150
Sequence CCTGGGGTGATTGGCAAGGGCAG AGGGGTGGGGCTGACTGACTAGG
Strand - +
Off-target summary {0: 9, 1: 1, 2: 23, 3: 28, 4: 222} {0: 8, 1: 0, 2: 0, 3: 22, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!