|
Left Crispr |
Right Crispr |
| Crispr ID |
1130268411 |
1130268416 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:82430325-82430347
|
15:82430347-82430369
|
| Sequence |
CCTTCAGCAAGCAGCCCAGTCCC |
CTGCCCTTGCCAATCACCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 12, 2: 14, 3: 24, 4: 270} |
{0: 9, 1: 1, 2: 23, 3: 28, 4: 222} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|