|
Left Crispr |
Right Crispr |
| Crispr ID |
1130304571 |
1130304575 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:82704587-82704609
|
15:82704601-82704623
|
| Sequence |
CCTTGTCCCATCTGTGTGGAACC |
TGTGGAACCCCACTGGAAATCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 85, 2: 301, 3: 275, 4: 259} |
{0: 2, 1: 65, 2: 317, 3: 218, 4: 212} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|