ID: 1130590813_1130590821

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1130590813 1130590821
Species Human (GRCh38) Human (GRCh38)
Location 15:85209355-85209377 15:85209391-85209413
Sequence CCCTTGTTGGCCCATGCCAGGAC GCTTCTCCATGGCCCCCTGCAGG
Strand - +
Off-target summary No data {0: 8, 1: 2, 2: 5, 3: 28, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!