ID: 1130884272_1130884275

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1130884272 1130884275
Species Human (GRCh38) Human (GRCh38)
Location 15:88080555-88080577 15:88080585-88080607
Sequence CCCAAAGGCAACTGGCAATTTAC AGTTACTCCAAAAGCCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 150} {0: 1, 1: 0, 2: 0, 3: 4, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!