ID: 1130971768_1130971774

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1130971768 1130971774
Species Human (GRCh38) Human (GRCh38)
Location 15:88739388-88739410 15:88739407-88739429
Sequence CCGACCTGGCCCTCTGGGAATAC ATACTGTCCTGGCTCCAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!