ID: 1130990888_1130990898

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1130990888 1130990898
Species Human (GRCh38) Human (GRCh38)
Location 15:88875050-88875072 15:88875090-88875112
Sequence CCTGCCGAGGGTAAGCCGGCAGG ACCTCCGCTGCCTGGGAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65} {0: 1, 1: 0, 2: 0, 3: 10, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!