ID: 1131049107_1131049110

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1131049107 1131049110
Species Human (GRCh38) Human (GRCh38)
Location 15:89334679-89334701 15:89334697-89334719
Sequence CCTCACGGTGCTTCCCGGTCTGC TCTGCTGCTCCCCCGACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76} {0: 1, 1: 1, 2: 6, 3: 42, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!