ID: 1131049107_1131049111

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1131049107 1131049111
Species Human (GRCh38) Human (GRCh38)
Location 15:89334679-89334701 15:89334704-89334726
Sequence CCTCACGGTGCTTCCCGGTCTGC CTCCCCCGACCCCAGGCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76} {0: 1, 1: 0, 2: 7, 3: 83, 4: 601}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!