ID: 1131049109_1131049116

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1131049109 1131049116
Species Human (GRCh38) Human (GRCh38)
Location 15:89334693-89334715 15:89334709-89334731
Sequence CCGGTCTGCTGCTCCCCCGACCC CCGACCCCAGGCCCACGGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 427} {0: 1, 1: 0, 2: 0, 3: 23, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!