ID: 1131049114_1131049129

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1131049114 1131049129
Species Human (GRCh38) Human (GRCh38)
Location 15:89334708-89334730 15:89334743-89334765
Sequence CCCGACCCCAGGCCCACGGCACG GCGCGGCCTACGCAGCCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 275} {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!