ID: 1131121032_1131121041

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1131121032 1131121041
Species Human (GRCh38) Human (GRCh38)
Location 15:89823525-89823547 15:89823550-89823572
Sequence CCCCAGGGCAGGGCAGGGCAGGG CCTGCAGAGGAATGCTGGGTAGG
Strand - +
Off-target summary {0: 13, 1: 19, 2: 41, 3: 241, 4: 1248} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!