ID: 1131121032_1131121042 |
View in Genome Browser |
Spacer: 5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1131121032 | 1131121042 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 15:89823525-89823547 | 15:89823553-89823575 |
| Sequence | CCCCAGGGCAGGGCAGGGCAGGG | GCAGAGGAATGCTGGGTAGGAGG |
| Strand | - | + |
| Off-target summary | {0: 13, 1: 19, 2: 41, 3: 241, 4: 1248} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||