ID: 1131832263_1131832269

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1131832263 1131832269
Species Human (GRCh38) Human (GRCh38)
Location 15:96361363-96361385 15:96361404-96361426
Sequence CCCTTTCTCCTCTGGGGGAGGTT AACCCCAGCTCCTCGCATCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!