ID: 1132344703_1132344718

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1132344703 1132344718
Species Human (GRCh38) Human (GRCh38)
Location 15:101101212-101101234 15:101101261-101101283
Sequence CCGGGCCAAGCTCATTCATTCCC AGGATCCCGCTGAGGGATACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!