ID: 1132519460_1132519470

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1132519460 1132519470
Species Human (GRCh38) Human (GRCh38)
Location 16:380839-380861 16:380866-380888
Sequence CCGCATCAGCTGCCGGGCACCTG CCCGCGTGGCTGGGGACGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 160} {0: 1, 1: 0, 2: 2, 3: 10, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!