ID: 1132543132_1132543139

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1132543132 1132543139
Species Human (GRCh38) Human (GRCh38)
Location 16:520764-520786 16:520809-520831
Sequence CCGCCTGCAGGACTACATCGACA GACCAACCCGTCCATCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54} {0: 1, 1: 0, 2: 1, 3: 7, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!