ID: 1132694191_1132694196

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1132694191 1132694196
Species Human (GRCh38) Human (GRCh38)
Location 16:1194768-1194790 16:1194781-1194803
Sequence CCCGGCCAGGCGCAGGCCCCAGG AGGCCCCAGGCGCCACCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 75, 4: 632} {0: 1, 1: 0, 2: 6, 3: 36, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!