ID: 1132712667_1132712681

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1132712667 1132712681
Species Human (GRCh38) Human (GRCh38)
Location 16:1276466-1276488 16:1276505-1276527
Sequence CCCACAATGCCCACCAGGTCATT GGGAACAACAGAAGGAGGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!