ID: 1132729650_1132729658

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1132729650 1132729658
Species Human (GRCh38) Human (GRCh38)
Location 16:1355122-1355144 16:1355150-1355172
Sequence CCCGCCTCTGCGGGGTCGGGTGT GTCTCCCGCGTCTGTGGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 6, 4: 86} {0: 2, 1: 3, 2: 3, 3: 6, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!