ID: 1132729653_1132729658

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1132729653 1132729658
Species Human (GRCh38) Human (GRCh38)
Location 16:1355126-1355148 16:1355150-1355172
Sequence CCTCTGCGGGGTCGGGTGTGGAT GTCTCCCGCGTCTGTGGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 77} {0: 2, 1: 3, 2: 3, 3: 6, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!