ID: 1132738134_1132738157

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1132738134 1132738157
Species Human (GRCh38) Human (GRCh38)
Location 16:1397513-1397535 16:1397557-1397579
Sequence CCCCACCCCGACCCCCGTGCTTC CTGGGGATGAGGAGGTGTCAGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 6, 3: 45, 4: 463} {0: 5, 1: 0, 2: 6, 3: 55, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!