ID: 1132738163_1132738186

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1132738163 1132738186
Species Human (GRCh38) Human (GRCh38)
Location 16:1397600-1397622 16:1397644-1397666
Sequence CCCCACCCCGACCCCCGTGCTTC CTGGGGATGAGGAGGTGTCAGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 6, 3: 45, 4: 463} {0: 5, 1: 0, 2: 6, 3: 55, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!