ID: 1132738222_1132738244

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1132738222 1132738244
Species Human (GRCh38) Human (GRCh38)
Location 16:1397775-1397797 16:1397818-1397840
Sequence CCCACCCCGACCCCCGTGCTTCA CTGGGGATGAGGAGGTGTCAGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 3, 3: 15, 4: 217} {0: 5, 1: 0, 2: 6, 3: 55, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!